How Efficient Are The Oral Anticoagulants Over Warfarin Assignment

How Efficient Are The Oral Anticoagulants Over Warfarin - Assignment Example On the other hand, the action new oral anticoagulants in the body; dabigatran, in this case, can be reversed using hemodialysis. This method works to remove dabigatran from the body in 3 hours hence it can be used to treat dabigatran toxicity. Dabigatran, rivaroxaban, and apixaban are eliminated from the body through the renal system. Before their administration, clinicians are advised to diagnose and ascertain the patient's creatinine clearance using the Cockcroft-Gault formula. This will help in determining the dosage requirement for various patients. In warfarin administration, there is no agreed mechanism of administering the dosages to patients. The drug has been in use for 60 years yet clinicians do not have a clear basis for determining the right amount of the drug to be administered to patients. Various factors that inhibit the function of warfarin have been identified and they vary from patient to patient. This makes it difficult for clinicians to ascertain the correct dosag e for various patients. This is one of the reasons that make warfarin less effective and more dangerous compared to the new oral anticoagulants. All the above arguments present evidence against the use of warfarin. It limitations has made it ineffective for clinical use but despite this, it is still used by clinicians all over the world since there is no established cure for the conditions it treats. New oral anticoagulants, on the other hand, have been found to have lesser flaws and are more effective in treating patients with nonvalvular AF.

Diversity in The Workplace Essay Example for Free

Diversity in The Workplace Essay Diversity has several definitions. According to Schmidle (2010), workplace diversity is a people issue, focusing on the differences and similarities that people bring to an organization. It is usually defined broadly to include dimensions beyond those specified legally in equal opportunity and affirmative action non-discrimination statues. Diversity is often interpreted to include dimensions which influence the identities and perspective that people bring, such as profession, education, parental status and geographic location. If you think of diversity and all of the categories it can be a bit overwhelming. Schmidle did leave out several categories that include age, gender, income level, social status, political views, religion, and marital status. The word â€Å"diversity† has a kind of conflict ring to it but it doesn’t necessarily mean it is a bad thing. Diversity can in fact be a good thing. Schmidle later goes on to discuss some of this positive outcomes of diversity including one of the most important aspects of diversity which is learning new things from others. If we are around the same people everyday that are the exact same and do things the exact same it is hard for people to think outside the box. This paper will discuss positive and negative aspects of diversity focusing on age. It will also discuss other forms of diversity as well. When discussing age diversity it is important to discuss the different categories. Individuals over 60 are considered to be the Traditionalist generation. Individuals in their mid-40’s to 60’s are baby boomers. Those in their late 20’s to early 40’s are in the Generation X category and the most recent generation is Generation Y who are early 20’s or younger (Bell, Narz, 2007). Each one of these groups has been described as having certain characteristics. Traditionalists are defined as having a more traditional  working environment. They typically work 9:00 A.M. to 5:00 but are said to work late and weekends during busy periods if necessary. Traditionalist are also said to be hard working, loyal employees who respect authority. It is typical for wives of this category to have been home with the children while the male is or was at work bringing in the sole income. Traditionalists are retiring from the work force at a steady rate but still remain influential in today’s working environment (Bell, Narz 2007). Baby Boomers are the children of Traditionalists and also thought to have a strong work ethic. A difference between Boomers and Traditionalists is that they are dual-career couples with the women working as well as the men. Boomers are said to question authority and have also been labeled the â€Å"me generation† (Bell, Narz 2007). Generation Xers are the children of Baby Boomers. They have grown up watching their parents working to try and have it all and have been affected by their parents working hard and late hours. They are more family and parent oriented, optimistic and confident. They are said to not have a very strong loyalty to their employer and tend to work for someone that best fits their needs (Bell, Narz 2007). Generation Y are the children of Generation X and are also called the millennials, the internet generation, and also the Echo Boomers. This is due to their computer knowledge and also due to them being one of the largest generations since the Baby Boomers. At a young age they were introduced to different lifestyles and cultures in school. Being that they were exposed so young they tend to have more accustomed to different races, sexual orientation, and ethnic groups. Generation Ys like to be challenged and want flexibility and telecommuting options. They are also family oriented and want to work part time or time off when having children (Bell, Narz 2007). After describing these different groups it is clear there is a difference in attitude, respect, loyalty, goals, and work ethic. Putting all of these individuals in a working environment together would seem like a very bad idea. Schaefer 2010 States: The popular press paints a picture of generational divide at work. Mature workers (Traditionalists and Baby Boomers) are portrayed as loyal and hardworking, but dinosaurs when it comes to innovation and technology. Younger employees (Generation Xers and Millennials) are viewed as innovative, but disrespectful, lazy, and egocentric. Taken at face value, these stereotypes can lead to conflict and turmoil in the workplace. Schafer later describes that this is not the case and actually have more similarities than differences. She also informs the reader that age diversity is a value to our organizations and will be a â€Å"an important component in the divers workforce of the future.† (Schaefer, 2010). What are some benefits and who does it affect? One benefit is respect. By respecting others differences productivity increases which can affect an employee and an organization economically, financially and competitiveness (Green, 2008). By being more productive the company makes more money, which makes it possible for them to be competitive. When a company makes more money it is easier for them to give raises and bonuses. Also when a company has diversity in the workplace it can reduce lawsuits and increase marketing opportunities, recruitment, creativity, and business image (Green, 2008). Diversity is not only positive. It can be if you have the right group of people working but for the most part managers will find obstacles and challenges. When I was managing I always said it only takes one individual to destroy a group’s character and flow. This type of person looks for problems and gets the rest of the group members worked up. Something simple like a gossiper can ruin a group’s charisma. If a group member is racist or not accepting of particular member’s religious views or sex it can also affect the rest of the group (Green, 2008). This can lead to the loss of personnel and effect work production which in turn affects the employees and organization economically, financially, and its competitiveness. Also if an individual is not socially accepting of others it affects the companies view to the customers and shareholders. The chain fast food restaurant Chik-Fil-A has recently announced it does not support same sex marriage. The public exploded with outrage and tens of thousands of people vowed to never eat  there again. If a business employs an individual who voices their discrimination, prejudice, or stereotyping of a particular group the same outcome could happen if left unchecked. I think for the most part we could all agree the older generation was not as accepting to different races, religion, and sexual preference as much as the younger generation is. This certainly does not mean a younger person would not be discriminatory or that all Traditional workers are discriminatory but it is something managers need to understand. Business will typically have a note on discrimination in their by laws or employee hand books that any form whether it be for age, sex, ethnicity, sexual preference will not be tolerated. Colleges employing individuals will have this as well. An example of this is the University of California’s system wide non-discrimination statement: â€Å"It is the policy of the University not to engage in discrimination against or harassment of any person employed or seeking employment with the University of California on the basis of race, color, national origin, religion, sex, gender identity, pregnancy, physical or mental disability, medical condition (cancer-related or genetic Characteristics), ancestry, marital status, age, sexual orientation citizenship, or status as a covered veteran. This policy applies to all employment practices, including recruitment, selection, promotion, transfer, merit increase, salary, training, and development, demotion, and separation. † (University of California, 2011). Having non-discrimination statements like this allows employees, the public, shareholders, and other colleges or competition see discrimination of any kind will not be tolerated at the school. This can help the business have a positive image to all who read it. It is fairly uncommon to find a current business without some form of discrimination statement. The one from the University of California above is very descriptive and most that I have found do not go into this much detail. The University of California also has their Principles of Community: â€Å"We recognize, value, and affirm that social diversity contributes richness to the University community and enhances the quality of campus life for  individuals and groups. We take pride in our various achievements and we celebrate our differences.† (University of California, 2011). These types of guiding principles allows the community and any other readers know the University welcomes differences in individuals. If someone was having any reservations about attending this University or working for them this further assures the individual the University would welcome them no matter how different they are. Age diversity can also affect the way a person is treated. If you think about front-line management, mid-management, senior management you typically vision an older individual at the senior management level, a slightly younger individual at the mid-management level, and again a slightly younger individual at the front-line management level. Does age have to do with getting promoted? If I simply get older will I be promoted? Apparently it does not but it does have a huge impact on getting dismissed. If an employee is more than twenty percent younger than their superior they are more likely to be let go. If the employee is less than twenty percent younger than their superior they are less likely to be let go (Giuliano, Leonard, Leving, 2006). This study shows a superior is much more likely to dismiss someone who is considerable younger than them compared to if the employee is rather close in age. The workforce demographics are also shifting. It has been reported workers in the age group of 55-64 there will be 36.5 percent more compared to 2006. That is a drastic increase. What about those ages 65-74 and employees 75 and up? There is projected an 80 percent increase in both. This means people are working longer and past the retirement age (Schaefers, 2010). This also lets us know age diversity with the Generation X needs to be paid attention to by employers. Many feel we have a solid understanding of this group already while others feel we have been focusing on the Traditional workers more. Whatever the case it is pretty clear employers will need to be prepared to provide for this generation and others who follow. How do we do that? We need to understand how each generation feels and act. Mature workers value loyalty from and to the company. They often few their younger co-workers as not having enough company allegiance. Generation Xers are considered to be loyal to a team, boss, or project but  not necessarily a company. Baby Boomers and Traditional workers may view this as disrespectful and it could cause conflict (Schaefers, 2010). We need to understand the core values of generations. Many values are shared between generations. The Traditionalists raised the baby Boomers. The Baby Boomers raised the Generation X and the Generation X raised the Generation Y. It is easy to understand some of the traits of the older generations have been passed down especially family. It did take some negative steps at times. The traditionalist taught their children to work hard and be loyal. This had a kind of family second effect and the Generation X was affected by this. They are very family oriented and family always comes first. So an employer would need to know that if they plan on keeping Generation X employees around they need to allow them to have flexible schedules and they need to be able to take time off for family(Schaefers, 2010). We need to expand our communication approaches as well with the other groups coming up. The millennial generation is extremely technology oriented and it is very important in their lives. This generation does most of their business through electronics and technology as well as their personal life (Schaefers, 2010). One of the major characteristic an employer should have and should instill on all employees is to show respect to one another. A younger employee does not want to get disrespected for a possible new and out of the box idea just as an older employee doesn’t want to disrespected for doing something the same way for so long. We have all heard treat others like you would like to be treated and it holds a lot of weight when trying to get different generations to work in a cohesive and productive manner (Schaefers, 2010). Productivity is another topic employer and employees are concerned with. Some feel the older workers do not work as hard or are productive as younger employees. Some decide this is true whether or not it is and respond to it. Making comments or speaking to other employees and management about the lack of work is one form. The truth is studies have shown this is not necessarily true in all cases. A three year study was conducted with a hardware chain. One store was staffed with only employees over the age of fifty, while the other five stores were staffed with younger employees. The over fifty store was considerably more productive in major business aspects than two of the other five stores and was close to the other three in sales generated against labor costs (Robbins, Judge, 2011). This is an impressive study that can refute arguments that the older individuals are not worth employing. Employers carry mixed feelings about older worker. Some feel they are more loyal, have more experience, better judgment, and stronger work ethic. Others feel they lack in flexibility and are not accustomed to today’s technology. When these employers are looking for new hires it is common for the older applicants to be looked over and if they are hired they are usually the first to go when it comes to layoffs (Robbins, Judge, 2011). The opportunity to quit is also a concern for employers. Given that an older applicant has fewer employment opportunities it is thought some employers hire these individuals based on the idea that they will not leave once hired. The younger applicant is thought to have greater opportunity and a more willingness to change jobs or jump ship if the job is not what they expected. They younger generations are also thought to expect the employer and business to take care of there needs better than the older generations (Robbins, Judge, 2011). Some companies realize the value in older employees and actually make attempts to attract them. Boarders and the Vanguard Group have realized the value and have offered benefits and options that lure them in. Flexible hours and part time work are a couple of the things the older workers are looking for. Since most have at least thought about retirement if not already been retired, these groups of workers enjoy spending time with family and doing the things they enjoy. Most states have agreed that a mandatory retirement is not necessary the pool of aged workers has increased dramatically. No longer is it required for individuals to retire at the age of 70. This has led a lot of workers to reinter or continue to be a part of the labor force. Some have lost loved ones and wish to socialize which they would not be able to do if they simply stayed home. The opportunity gives  them a reason to try and make new friends and also gives them a reason to stay busy. Others may have not prepared or had the opportunity to save up a proper retirement with today’s increasing prices and declining economy (Robbins, Judge, 2011). The employee’s job satisfaction needs to be considered when it comes to the diversity of age in a workplace. Employees over the age of 60 who are non professional’s satisfaction rate decreases during their middle ages and increases as they get older. Professional employees who were over the age of 60 however continually increased as they aged (Robbins, Judge, 2011). One of the ongoing concerns with diversity is if they want it. As discussed there are many advantages of having diversity in the workplace. If a company wants to grow it is important to allow new and different people to bring different things to the office table. This is so true that some literature can be found on how to increase workplace diversity. The most important decision for a company is to decide what kind of diversity they need. It may not be the best idea for a company whose main product is A company that sells women’s jewelry may n References Robbins, S.P., Judge, T.A. (2011). Organizational Behavior(14 ed.). Upper Saddle River: Prentice Hall. Notter, Jamie (2009). Generational Diversity in The Workplace. Retrieved 30 August 2012 from Convergence Media: http://www.multiculturaladvantage.com/recruit/group/mature/Gen eral-Diversity-in-workplace.asp Schaefers, Kate (2010). Age Diversity in the Workplace. Retrieved 31 August 2012 from Careers Thought Leaders: http://www.careerthoughtleaders.com/blog/age-diversity-in-the- workplace/ Schmidle, Deborah and Woods, Susan (2010). Workplace Diversity. Retrieved 31 August 2012 from Catherwood Library: http://www.ilr.cornell.edu/library/research/subjectguides/work placediversity.html University of California (2011). Managing Diversity in the Workplace. Retrieved 27 August 2012 from University of California: http://ucsfhr.ucsf.edu/index.php/pubs/hrguidearticle/chapter- 12-managing-diversity-in-the-workplace/ Green, Kelli A. and Lopez, Mayra (2008). Diversity in the Workplace: Benefits, Challenges, and the Required Managerial Tools. Retrieved 31 August 2012 from University of Florida: http://www.edis.ifas.ufl.edu/hr022 Greenberg, Josh (2004). Diversity in the Workplace: Benefits, Challenges, and Solutions. Retrieved 31 August 2012 from AlphaMeasure,Inc.: http://multiculturaladvantage.com/recruit//Diversity-in-th- Workplace-Benefits-Challenges-Solutions.asp Bell, Nancy Sutton and Narz, Marvin (2007). Meeting the Challenges of Age Diversity in the Workplace. Retrieved 31 August 2012 from New York State Society of CPAs: http://www.nysscpa.org/cpajournal/2007/207/essentials/p56.htm United States Department of Labor (2010). Employee Tenure Summary. Retrieved 4 September 2012 from United States Department of Labor: http://www.bls.gov/news.release/tenure.nr0.htm Giuliano, Laura, Leonard, Jonathan and Levine, David I. (2006). Do Race, Age, and Gender Differences Affect Manager-Employee Relations? An analysis of Quits, Dismissals, and Promotions at a Large Retail Firm. Retrieved 4 September 2012 from http://moya.bus.miami.edu/~lgiuliano/Quits.pdf

Comparison of Techniques for Diagnosis of Multiple Sclerosis

Comparison of Techniques for Diagnosis of Multiple Sclerosis Background: There is increased need to develop specific biomarkers for multiple sclerosis (MS) to aid in the diagnosis, improve the management of patients and the monitoring of the effectiveness of treatment. Oligoadenylate synthetase 1 (OAS1) is up regulated by type 1 interferon. A single nucleotide polymorphism (SNP) in exon 7 of OAS1 results in differential enzyme activity. Objective: To correlate different OAS1 genotypes, in patients with relapsing remitting multiple scleroses (RRMS) under interferon-beta (IFN ÃŽ ²) therapy, with disease activity. Subjects and Methods: OAS1 genotype was assessed in 20 patients with RRMS and 20 age and gender matched healthy controls. All patients were medicated with IFN ÃŽ ². The patients were subdivided in terms of disease activity assessed by Expanded Disability Status Scale (EDSS), in two groups; group I with minimal disease activity and group II with severely active disease. All patients were followed up every 6 months for a period of 2 years . Results: Genotyping analysis of the OAS1 gene revealed a significant difference between RRMS patients and control group, with lower frequency of GG in patients (25%) compared to controls (65 %) (p = 0.0001). Furthermore, AA genotype was detected 35% of patients compared to 0% in controls (p = 0.01). Regarding disease activity, AA genotype had a significantly higher frequency (71.4%) in patients with severely active disease compared to 15.4% in patients with minimally active disease (p=0.0001). Conclusions: The A-allele is considered risky and the G is protective, so those with the AA genotype in particular should be carefully monitored for evidence of disease activity. Conversely, GG genotype may protect against increased disease activity. Introduction Multiple sclerosis (MS) is an inflammatory demyelinating disease of the central nervous system, the etiology and pathogenesis of which remain largely elusive. The most common form of MS is the relapsing–remitting form (RRMS), in which episodes of acute worsening of neurological function (relapses) are followed by partial or complete recovery periods (remissions) free of disease progression.1,2 Type 1 interferons (IFNs) are innate immune cytokins that activate the JAK/Stat signaling pathway leading to induction of IFN-stimulated genes. The 2,5-OAS family is central to the IFN antiviral pathway for viruses whose replication includes production of double-stranded RNA. One member of this family of proteins, OAS1, induces RNAseL, resulting in degradation of viral RNA, inhibition of virus replication, and promotion of cellular apoptosis.1 Several OAS1 polymorphisms have been reported; one located at the exon 7 splice-acceptor site results in alternative splicing of the OAS1 mRNA. Although clinical trials have proven the efficacy of interferon-beta (IFN ÃŽ ²) in the treatment of RRMS2-4, over one-third of patients have continuing significant disease activity.5 On purely clinical grounds, patients have variously been considered to have responded poorly, based on relapse occurrence6-9 or on disability progression while receiving IFN ÃŽ ² therapy.10 Therefore, cohorts of patients receiving IFN ÃŽ ² can be informative for evaluating general determinants of disease activity. Aim of work: to examine the relationship between OAS1 genotype and indices of disease activity in RRMS under IFN ÃŽ ² therapy. Subjects and Methods Twenty patients with RRMS according to revised McDonald criteria11 were enrolled from an outpatient and inpatient population attending Neurology Department, Tanta University Hospital. Twenty unrelated age- and gender-matched volunteers, with no history of MS or other neurologic disease, were recruited as a control group. All patients received IFNÃŽ ² therapy and followed up every 6 months over a period of 2 years from January 2010 to January 2012. The Ethics Committee of Hospital approved the study, and a written informed consent was obtained from each participant. For all patients, baseline data collected included disease duration, age at onset, relapse history prior to therapy, and clinical disability measured using the Expanded Disability Status Scale (EDSS).12 Relapses were defined as an episode of neurologic disturbance lasting for at least 24 hours and not caused by a change in core body temperature or infection.13 Disability progression was defined as an increase in EDSS score by 1 point from baseline confirmed at 6 months.5 Genomic DNA was isolated from peripheral blood samples. Primers were designed to specifically amplify a 347-bp product surrounding the rs10774671 SNP. A total of 5 grams of genomic DNA was amplified by PCR. Primer sequences used were; rs 10774671 – forward, TCCAGATGGCATGTCACAGT and reverse, AGAAGGCCAGGAGTCAGGA. Amplification conditions included initial denaturation at 94 centigrade for 2 minutes, followed by 28 cycles at 94 centigrade for 20 seconds, 62 centigrade for 40 seconds 72 centigrade for 30 seconds, with a final extension for 7 minutes at 72 centigrade. The PCR products were digested with the ALU1 restriction enzyme. Digested products were analyzed by agrose gel electrophoresis and genotypes were assigned, the A-allele coding for a truncated form with low activity and the G conferring high enzymatic activity. Patients were assigned to 1 of 2 groups. Group I included minimal disease activity; patients who experienced a maximum of 1 relapse after 24 months of IFNÃŽ ² therapy and had no sustained disability progression. Group II included a severely active disease; patients who had 2 or more relapses on IFNÃŽ ² therapy over 24 months with or without sustained disability progression.14 Statistical Analysis SPSS 10 was used for data analysis.15 P value

Essay on Brutalities of African Society in Chinua Achebes Things Fall

Brutalities of African Society Exposed in Things Fall Apart      Ã‚   David Carroll writes, of the novel Things Fall Apart, "This incident is not only a comment on Okonkwo's heartlessness. It criticizes implicitly the laws he is too literally implementing..." (Carroll) The incident that David Carroll refers to is the death of Ikemefuna. Ikemefuna was a young boy who was handed over to the village of Umuofia as compensation for the murder of one of that village's citizens. He is handed over to Okonkwo, a great man in the village, to whom he gives every affection. The brief life with Okonkwo and death of this innocent young man, and the life of Okonkwo himself, is a microcosm of life in Umuofia. Inconsistencies, brutalities, and conflict abound in even the highest of Umuofian life. And as Ikemefuna is led off to be murdered by the man he calls father, "the whole tribe and its values is being judged and found wanting" (Carroll).    When Ikemefuna first arrives in Umuofia, he is housed with Okonkwo because Okonkwo is a great man in the village. He had reached his prime and was a man of wealth. Ikemefuna quickly befriended Okonkwo's eldest son and began calling Okonkwo "father." Soon, however, this seeming peace and civility in the village and the life of the villagers disappears. Okonkwo receives a message from the village elders that the boy, the town's innocence, must be killed off. The boy is lead off to the slaughter completely unaware of his fate, and with his "father" in the company of the killers. When a machete is drawn and the black pot atop Ikemefuna's head is cut down, the boy runs to the man he loved as father. It is he who, lacking the courage to confront the others with his love for the boy, draws his machete and... ...e on the things that held us together and we have fallen apart" (Achebe, 176). The village of Umuofia held to backward laws and values that "destroy innocent children" (Achebe, 146). The tribe's innocence had to die in order for those who survived to mature. Although Umuofia's peak of innocence may have been when Ikemefuna was handed over to the village, but its maturity would come through the death of Ikemefuna, the tribe's innocence, at the hands of those the tribe called "father." Things Fall Apart clearly illustrates the faults of the African system and way of life through "the series of catastrophes which end with his [Okonkwo's and Umuofia's] death" (Carroll).    Works Cited Achebe, Chinua. Things Fall Apart. New York, New York: Bantam Doubleday Dell Publishing Group, Inc., 1994. Carroll, David. Chinua Achebe. New York: St. Martin's Press, 1980.

A Study of Globalisation Essay

Executive Summary This paper attempts to make sense of globalisation from a social and business perspective. Initially I will talk briefly about globalisation within our community and the different stand points those communities and individuals have taken; for and against globalisation. I will then talk about the multinational companies that have made the phenomenon of globalisation possible and these companies various impacts on societies and local communities around the world. The topic is further analysed by using multinational food retailing companies in Latin America as a case study. Displayed to the reader through this case will be a clear indication of how local communities and in particular their farmers are affected by globalisation and multinational companies. There are many different views on globalisation; and those against it oppose many different aspects of it. One of the countless reasons why there are anti-globalisation activists is due to the following: Multinational food retailing companies, the backbone of what is known as ‘globalisation’ within the supermarket industry, have in many cases entered small farming communities around the globe and destroyed a way of life for many of the farmers and labourers around them. Within Latin America these farmers have been forced to flee their homes to find refuge within the slums of the urban sprawls within their cities or even to cross borders into the USA. Introduction to Globalisation Definition: Globalisation can be defined as ‘ the intensification of worldwide social relations which link distant localities in such a way that local happenings are shaped by events occurring many miles away and vice versa’ (Giddens 1990). It has also been described as ‘ process which embodies a transformation in the spatial organisation of social relations and transactions – assessed in terms of their extensity, intensity, velocity and impact – generating transcontinental or inter-regional flows and networks of activity’. (Held, et al 1999) In relation to Latin America (the major area of discussion of this paper) globalisation can be defined as a practice or system that has affected several of the continents most persistent problems. Such problems would be the diverse extent of economic exploitation and social disparity that has branded Latin America ever since it’s European colonisation in the sixteenth century. (Harris & Halebsky 1995) Pro-globalisation: Free trade fosters prosperity and has an extremely important characteristic that affects our way of life. This characteristic is actually it’s tendency to be able to prevent war. Extensive research has shown that trade promotes peace both directly, by reducing the danger of military divergence, and indirectly, by promoting prosperity and democracy (Weede 2004). Globalisation and free trade in the 20th century and beyond can be compared with the 19th Century expansion of empires (like the British Empire). These empires built an infrastructure in developing countries; railways, ports and beautifully constructed colonial buildings were just some of the benefits these developing countries could take advantage of. Even though these commodities weren’t built for the benefit of the developing country (they were built for British trade) they still ultimately increased these countries abilities to trade and to become technologically independent. In the 20th Century infrastructure, technology, health and education systems implemented by the world powers, in developing and developed countries, has improved the overall quality of life for people worldwide, this does not include Africa. The average GDP for all countries except Africa has gone up; however the downside is; the difference between the rich and poor countries has also increased. The reason for this is that the countries introducing themselves to the developing countries are actually gaining a much more significant benefit. Anti-globalisation: This term is more commonly attributed to the political standpoint of certain people, groups and organisations that are in opposition to certain facets of globalisation. Those in resistance often oppose large multi-national company’s dominance of global trade agreements and trade-governing bodies like WTO (the World Trade Organisation) (Graeber 2002). Otherwise known as a social movement, anti-globalisation represents its participants in their opposition to large corporations who endeavour to attain and ‘have’ attained political power. Political power can be put into effect via international trade agreements, anti globalisation activists scrutinize these agreements, stating that they quite often undermine ‘the environment, labour rights, national sovereignty, the third world, and other various aspects of our everyday lives as human beings’ (Graeber 2002). It is common knowledge that globalisation and free trade can affect developing countries negatively, however, the worlds most developed countries and the people who live within them are also affected negatively. Globalisation forces job opportunities from these developed countries to other countries around the world and low skilled workers in developed countries lose their jobs. This increases the difference between the rich populace and poorer populace in that country. The following quote, from the United Nations, backs this statement up and shows us why there are anti-globalisation activists. ‘The richest fifth of the world have 80% of the world’s income and the poorest fifth have 1%; this gap has doubled between 1960 and 2000’ (United Nations 1999) largely due to the impacts of globalisation. As displayed above, multi-national corporations play a substantial role within the theory and practice of globalisation, these corporations are powerful by nature and currently account for over 33 per cent of world output, and 66 per cent of world trade (Gray 1999). These organisations even though considered to be global companies are still heavily ‘nationally embedded’ in terms of their business activity (Hirst and Thompson 1996). Despite this; multinational corporations still have considerable economic and cultural power. The next section of this paper will talk about these companies, their branding and how they affect communities around the world. Globalisation & Multinational Companies Social Impact (How do they impact our local communities?) Branding: The main driving force for the growth of multi-national companies and the globalisation of their impact is in their brand (Klein 2001). In the mid-1980s a management theorists came up with a seemingly harmless idea that successful corporations must primarily produce brands, as opposed to products. This idea led to the exorbitant expansion of wealth and cultural influence we see in multinational companies today and over the past fifteen years (Klein 2001). ‘Brand builders are the new primary producers in our so-called knowledge economy’ (Klein 2001). Modern multinational companies have used a strait to the point yet brutally honest approach to branding over the past fifteen years. This approach is that companies should not disburse their limited capital on factories that will require physical maintenance, on equipment that will decay or on workers who will undoubtedly age and perish. As an alternative, they should focus that capital in the processes used to build their brands (Smith & Smith 2002). Multinationals: Multinational corporations are in actuality weak and vague organisations that generally display the corrosion of everyday values that afflict practically all late contemporary social institutions (Gray 1999). Diverse communities around the world are impacted and exploited by these multinational companies. They continually create or contract business in countries where they can profit from cheaper wages and assets. As discussed earlier this ‘can’ mean added wealth and infrastructure for that community. However, it quite often means increased levels of unemployment in the city/country where the industry was located beforehand. Not to mention that the wages payed and work environment in the communities where the operations are implemented are usually relatively poor (Smith & Smith 2002). Below are a few examples that articulate this situation perfectly: * ‘The numbers of people living on less than $2 per day has risen by almost 50% since 1980, to 2.8 billion-almost half the world’s population. And this is precisely the period that has been most heavily liberalized’ (World Bank 2000). * ‘The world’s poorest countries’ share of world trade has declined by more than 40 per cent since 1980 to a mere 0.4 per cent’ (UNCTAD 1999). This has been precisely the period in which the majority of multinational companies have grown exponentially, and is obviously a large factor resulting from their growth. Multinationals apart from affecting whole economic systems of countries and communities also attempt to create new markets within these communities. They search for new markets which have not yet been exploited in order to increase sales; it is typically carried out by creating new desires among target groups. The easiest target market for multinational companies to create new desires for is the child and youth market. Prized not only for the influence they have over adult spending but also for their own escalating spending power, the youth of today are one of the most profitable and influential markets (Kenway and Bullen 2001). Despite all this negative hype about multinational companies; they ‘have’ played a very significant role in the growth of globalisation. Around the world individuals and communities are linked much closer to each other and information and money flow quicker than ever before. Globalisation and it’s creation of multinationals has resulted in making goods and services in one part of the world increasingly available in ‘all’ parts of the world. International travel and communication is also much more frequent. In all globalisation has made life easier for those who can actually afford the luxuries of travel and international business. (Sourcewatch 2006). The Food Chain; Survival of the Biggest A case study of Latin America and the detrimental effects globalisation and multinational food retail companies have had on it’s local farmers. ‘Commodity prices have fallen dramatically, by some two thirds over the past 30 years, so that farmers have had to triple production just to maintain their incomes. One example among many: in just the last three years, Tanzanian farmers experienced a decline of 50% in the price of coffee.’ (OXFAM 2001) ‘While farmers earn less, consumers have been paying more.’ (O’Neill 2001) Although, according to the U.N. Food and Agriculture Organisation, Latin America produces four times the amount of food needed to feed the population, 58 million people are still malnourished. Introduction: During the 1980’s a transformation within Latin America began; this transformation was one that would shape the future of farmers all over the continent for decades to come. For some it would be a positive change, however a large majority found it to be the opposite. The transformation I talk about is opening up of trade barriers within Latin America in order to allow food retailing companies access to the regions ‘un-commercialised’ and fertile lands. During the 1990’s the revolution in food retailing within Latin America accelerated extraordinarily as countries unbolted their economies to suit conditions for financing from the International Monetary Fund and the World Bank. As Latin America’s overall FDI significantly increased; multinational food retailers bought out local chains and entered joint ventures with the obstinate ones. The greatest fears for farmers in the region were realised when the multinational companies introduced unfair trade rivalry from American and European growers with weighted financial backing. Small farmers are constantly left to compete with the biggest world players as these food retailing chains (products of globalisation) move from large cities to smaller towns and from economically sound countries to ones still developing their economic and social systems (Dugger 2004). These chains are now the prevailing force in the trade of processed foods and they’re produce sales are growi ng to a similar reputation. When global food retail companies dominate a market, there are scenarios whereby it can be seen to be advantageous for all the citizens within that community. Such a scenario would be when the economy, of the region being taken over, is growing energetically and spawning decent jobs for globalisations losers, because in spite of everything the chains ‘are’ creating cheaper, cleaner and safer shopping environments for these societies. Samuel Morley, a visiting research fellow at the International Food Policy Research Institute (IFPRI), has written extensively on inequality and labour economics in Latin America, he stated that â€Å"It would be an appealing transformation of the sector if alternative jobs could be made available,† however these scenarios never seem to materialise in Latin America and other developing countries/continents around the world as they do not have economies of great strength. As Latin America’s population grows its economic situation trails further and further behind. In Latin America, 220 million of the total regional population of 500 million people are poor. The case study that I will shortly talk about outlines just how bad the situation in Guatemala is, Guatemala is actually one of Latin America’s ‘better off’ regions, with supermarkets controlling 10-15% of grocery sales. Therefore the case gives you an indication of what the more unfortunate farming communities, in Latin America, must have to endure. For example in Argentina supermarket chains control 30% of this industry and in Brazil; 50% (Dugger 2004). Rural markets shrink throughout the continent, even though the victims of globalisation are pushed to trade within them, these rural markets are slowly but surely lost in the black holes that we call multinational companies. Within a single decade Latin America’s farming communities have been transformed by food retail giants such as Ahold and Walmart. These multinational goliaths have transfigured food distribution by offering low prices, a range of choices and convenience; they are now also changing the face of food growing (Dugger 2004). This could seem positive to some, however it is far from that; there are thousands of Latin American farming communities who have been devastated by the unforseen and overwhelming challenges that these companies bring (Dugger 2004). The major visible impact that these changes have had within the farming communities over the past decade is the great increase in the number of, now penniless, farming migrants entering the urban slums of their own countries and crossing the American border to seek refuge from their new ‘corporately governed’ country side. Guatemala’s Local Farmers Suffer (Case): Within the serene confines of the extraordinarily fertile and incredibly poor Guatemala, supermarket giants have crushed farmers to the point where they are no longer able to maintain operations within the land they once called home. Guatemala was once, not long ago, a place where people swapped produce for service and service for produce, money ‘was’ required to sustain they’re everyday living, however, life was effortless and uncomplicated up until the multinational giants arrived on Latin American shores. Guatemalan man Mario Chinchilla would inspect his field of sickly tomatoes on a daily basis; he would labour all day trying to meet the requirements of the new supermarkets which had opened up in town, however no amount of labour could possibly turn his crop into the stout, flawless product that Guatemala’s leading supermarket chain offered to it’s customers (Dugger 2004). A better product at a cheaper price, it seems good all round doesn’t it, but at the end of the day it has ruined many people lives. The chain I talk about is a giant Dutch multinational company named Ahold (Worlds 3rd largest retailer). The Chain is so large it includes names such as Bi-Lo and Stop & Shop under its ‘assets’. For some time Mario headed a farmer’s cooperative that was managing to sell produce to the chain however this proved to be an ephemeral opportunity whereby the multinational chain ran away with the locals hopes and dreams, leaving them to sit in their unsold crops of rotting vegetables. The reason for this was because the multinational retailers require farmers who encompass the proficiency and capital to invest in modern farming technologies such as; ‘greenhouses, drip irrigation and pest control’ (Dugger 2004). â€Å"They wanted consistent supply without ups and downs,† said Mr Chinchilla. â€Å"We didn’t have the capacity to do it† (Dugger 2004). Inequality, rebellion and violent repression within Latin America has been a recurring problem for many decades, during the 1990’s there was already a gap between rich and poor and the supermarket chains have simply added to this gap. This time Latin America has tried a different (non-violent) approach. In order to fight for their right to live comfortably in their homeland farmers joined forces; there are rare success stories, however many (like Mario Chinchilla and his Co-op) have suffered a more common fate. In Guatemala there is a tiny farming community named Lo de Silva; more than 300 farmers who originally belonged to Mr. Chinchilla’s co-op, ‘the Association of Small Irrigation Users of Palencia’, were from this village (Dugger 2004). Out of those 300 farmers there are only 8 still enduring the torment that globalisation has brought them. These remaining farmers aren’t even able to sell to the supermarkets they sell their product to middle men for severely discounted prices; to top this off the only product the middlemen will accept from them is salad tomatoes. Mr. Chinchilla’s case is an ideal example that demonstrates how the opportunity of success for small farmers is a remote prospect to most. Small farmers are simply getting left behind due to their lack of market pull and marketing/operational techniques (Dugger 2004). A ‘survival of the biggest’ situation has been created – ‘only the big can serve the big; the small need not apply, as global companies wipe out local distinctions in establishing a level economic playing field.’ (Hannaford 2006). During the 1990’s food retail conglomerates went from controlling between 10 and 20 percent of the Latin American market to totally dominating it (Economist.com 1997). During this period, in Guatemala specifically, the quantity of supermarkets has more than doubled; as their share of food retailed has reached 35 percent. The smaller shops and open air markets still remain and retail a great deal of fruits and vegetables in Guatemala. For customers to leave these historically enriched and characterised markets and enter the newly opened supermarkets in the region, is to leave behind Guatemala and enter a commercialised shopping centre that could reside in Hong Kong or London, with it’s marked down jumbo packages and symmetrical fruits in plastic trays. None of this, however, matters unless the bottom line is understood. The bottom line is that the rules of the World Trade Organisation are actually taking second place in importance to the privately set standards of the food retail giants. Also pressures from the I.M.F. and the World Bank to allow greater foreign investment into Latin America were proposed to formulate more competitive economies for them; however it is obvious that this model didn’t have a community element at its centre. Hardships have come from; not only what I described previously (the fact that the farmers must sell they’re produce at much cheaper prices, better quality and in a more convenient matter) but also from the fact that that they are now competing with the rest of Latin America, the United States and even the world because trade borders have been opened to allow almost ‘anyone’ import and export capabilities. Rigid opposition from internationally renound growers is now a reality for Central and Latin American farmers; at a distribution centre, for a subsidiary company of Ahold in Guatemala City, shipments of ‘apples from Washington, pineapples from Chile, potatoes from Idaho and avocados from Mexico’ are brought in (Hannaford 2006). Conclusion Globalisation has positive and negative affects on our society. This paper has outlined in great detail the negative affects of globalisation and multinational food retailing companies on Latin America’s and the world’s small farmers. The reason for this is due to the fact that there were; only on occasion, very rare and unusual success stories to be found about smaller farmers succeeding in their sales to companies such as Ahold and Walmart, within Latin America. After researching farming communities’ around the globe, it can be deduced that Latin America is not alone in this battle to produce food and sell it at competitive prices, while still maintaining some sort of meaningful social existence. Asian, African and Indian farmers; have been heavily exploited. Even farmers within more developed countries such as Australia have had to sell their products at severely discounted prices in order to satisfy multinational company standards. Farmers world wide, are however, not alone. Traditional strategies of help to farmers that feel the hardships of globalisation, such as providing fertilizers and improved seeds, are no longer enough to enable them to sustain their businesses. Professors and agronomists are banding together to document trends and develop new methods of help that will allow the fleeing farmers of Latin America, Africa and Asia to compete with others in selling products to the multinationals. In the midst of the these methods a few techniques stand out, such as; regulations put upon the multinationals that require farmers be paid promptly, laws that restrain these companies from dominating entire markets (such as mergers of supermarket chains) and enhanced hygiene and convenience through technology at open-air markets. After reading this paper I hope you too can conclude it is important that societies living within the limitations of this amazing world are given the chance to experience life’s pleasures and break out of the chain of inevitable failures that multinational corporations have brought to them. Being given the chance to make an honest and fair living, is only basic compassion and mercy; two marvellous characterises that any individual can encompass. If multinational food retail companies and global companies in general were able to, in some way, display this, then Anti-Globalisation would be a much less used expression. References * Dugger, C. W., (2004) Foreign Desk Late Edition – Final, Section A, Page 1, Column 1, New York Times – December 28, Tuesday. (http://www.nytimes.com) * Economist.com, (1997) Survey: Business In Latin America – Back on the pitch, The Economist print edition. * Giddens, A., (1990) Consequences of Modernity. Cambridge: Polity Press. * Graeber, D., (2002) New Left Review 13, January-February issue, ‘The New Anarchist’. * Gray, J., (1999) False Dawn. The delusions of global capitalism, London: Granta. 262 pages. * Hannaford, S., (Last updated 2006) Small farmers versus oligopolies: No contest, (http://www.oligopolywatch.com). * Harris, R. L., Halebsky, S., (1995) Capital, Power, and Inequality in Latin America, chapter: â€Å"The Global Context of Contemporary Latin American Affairs†, (Boulder. CO., Westview Press.) * Held, D., McGrew, A., Goldblatt, D. and Perraton, J. (1999) Global Transformations – politics, economics and culture, Cambridge: Polity Press. * Hirst, P. and Thompson, G., (1996) Globalisation in Question. London: Polity Press. * Kenway, J. and Elizabeth Bullen, (2001) Consuming Children: Entertainment, Advertising and Education, Open University Press. * Klein, N., (2001) No Logo, London: Flamingo. 490 pages. * O’Neill, B., (2001) What’s eating Us? OXFAM News. (http://www.oxfam.ca/news/WorldFoodDay/Whats_eating_us.htm) * OXFAM. (2001) Briefing Paper No 9, November. (http://www.oxfam.org.uk/search?SearchableText=Briefing+Papers&submit.x=19&submit.y=8) * Smith, M. K. and Smith, M., (2002) ‘Globalization’ encyclopaedia infed. (www.infed.org/biblio/globalization.htm) * Sourcewatch 2006 Globalisation, (Centre for Media and Democracy) http://www.sourcewatch.org/index.php?title=Globalization). * UNCTAD. (1999) Conference on Least Developed Countries. (http://www.unctad.org/Templates/Page.asp?intItemID=3073&lang=1) * United Nations. (1999) Human Development Report. * Weede, E., (2004) The Independent Review, Volume 9, number 2, ‘The Diffusion of Prosperity and Peace by Globalisation’. * World Bank. (2000) Global Economic Outlook Report. Washington: World Bank.(http://web.worldbank.org/WBSITE/EXTERNAL/DATASTATISTICS/0,,menuPK:232599~pagePK:64133170~piPK:64133498~theSitePK:239419,00.html)

Individual Memo Essays

Individual Memo Essays Individual Memo Essay Individual Memo Essay It allows for virtually any format for the paper rivers as well as processing government compliant CHAPS variations of the surveys that are being implemented in healthcare organizations nation-wide. The new system will provide user-centered experience and intuitive design to allow every branch of the business to operate effectively and efficiently. QPS system provides company-wide synergy and interoperability between the segments of the process from outbound production, to inbound processing to analysis and presentation of results to our clients. In order for the success of the project it is required for every business manager to undergo at least 1 0 ours of training to use the new system and to get familiar with host of new compliance policies. Stakeholders Executive Sponsors CEO CIO Users Analysts Outbound Production Inbound Production Development Project Managers Developers Objectives and Outcomes The main objective of this project is to streamline the production, processing, and analysis of medical satisfaction surveys across the company wide continuum while adhering to the government standards, privacy laws, and new compliance policies. The outcomes of this project include a accompanied roll of the new Qualifies Survey Processing System and end- seer training in order to effectively and efficiently utilize the new system to its full potential. Success Measurement Since National Research Corporation has chosen a value based approach to this project it will be measured by its efficiency, effectiveness, and ease of use. The value this new system provides to the company is measured in reduced costs of production, increased speed and volume of production, increased speed of processing, increased efficiency of processing and analysis of data, as well as increase in speed of end result delivery to our clients. The reject is aiming at impacting operational area of the company. The new system will increase effectiveness and efficiency all across the process. The new system will be faster, more dynamic and easier to use. The new process will increase the productivity by about 1 5%, processing and analysis time by 19%, end-result presentation speed by 17%. All around these numbers will have a huge impact on quality and speed of our service. This in turn will allow to increase the production and provide the ability to attain a larger number of big clients than we currently can handle.

Free Essays on Business And Managment

leadership is to help people do a better job through coaching, facilitating, and by creating environments that support the aim of the organization. Leadership is the ability of a manager to train employees, remove institutional roadblocks, and empower e... Free Essays on Business And Managment Free Essays on Business And Managment Management and Leadership Paper Within the organizational structure of most businesses you will likely find management and leadership coexisting. Commonly, the words are often substituted for on another. However, each word has a distinctly different definition. A manager does not necessarily make a good manager. Management is defined as those individuals in an organization that have the authority and the responsibility to manage the organization through the control of production processes and ensuring that they operate efficiently and effectively. Leadership is defined as the skills and ability to set future goals in accordance with the organizational goals and to communicate those goals to other employees in such a way that they voluntarily and harmoniously work together to accomplish those goals for the benefit of the organization. In this paper I will differentiate between management and leadership? Any organization needs to be managed, even a one-person company has to be managed. A manager has four key responsibilities: 1) planning, 2) organizing, 3) leading, and 4) controlling. Management can also be defined as the function that determines how the organization’s human, financial, physical, informational, and technical resources are arranged and coordinated to perform tasks towards achievement of strategic goals. Leadership implies that the manager has fundamental knowledge about critical processes. A leader is focused on ensuring the creation of strategies, systems, and methods for achieving excellence and building knowledge and capabilities. Leaders are focused more on creating an enthusiastic work environment for all of a company’s employees. In other words leadership is to help people do a better job through coaching, facilitating, and by creating environments that support the aim of the organization. Leadership is the ability of a manager to train employees, remove institutional roadblocks, and empower e...